mer scrambled shrna cassette  (OriGene)

Journal: Cell stem cell

Article Title: TFAP2C- and p63-Dependent Networks Sequentially Rearrange Chromatin Landscapes to Drive Human Epidermal Lineage Commitment

doi: 10.1016/j.stem.2018.12.012

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: The sequences of shRNA are as follows: KLF4 shRNA#1 (5’−3’): TGAGGCAGCCACCTGGCGAGTCTGACATG KLF4 shRNA#2 (5’−3’): TCAGATGAACTGACCAGGCACTACCGTAA Control shRNA: Scrambled negative control non-effective shRNA cassette in pGFP-C-shLenti plasmid (Cat. No. TR30021, Origene).

Techniques: Purification, Recombinant, Knock-Out, Blocking Assay, Plasmid Preparation, Clone Assay, SYBR Green Assay, Magnetic Beads, Staining, Sequencing, CRISPR, Negative Control, shRNA, Expressing, Software

Journal: bioRxiv

Article Title: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote differentiation of human neural stem cells

doi: 10.1101/2020.01.22.915934

Figure Lengend Snippet: A. Western blots shows WDR82 and human SETD1A/B expression following 100ng/ml BMP4 treatment. B. Representative images and quantitative graphs showing sphere formation in human StemPro® NSCs following treatment with siRNA for hSETD1A (siSETD1A) or shRNA for WDR82 (shWDR82) vectors versus controls (control siRNA, siCtrl and scrambled shRNA, scrCtrl). C and D. Real-time PCR (C) and western blots (D) showing expression of hSETD1A, WDR82, OCT4, CCND1 and NESTIN, following treatments as in B. E. Real-time PCR using DNA from ChIP with rabbit IgG and H3K4me3 and detected with promoter primers for OCT4, CCND1 and NESTIN following treatment with siSETD1A, shWDR82 or siCtrl, scrCtrl, in StemPro® NSCs. Error bars show the standard error of three independent experiments. (* p<0.05, ** p<0.01)

Article Snippet: Human short interference RNA (siRNA) against human SETD1A (Gene ID 9739, Cat# SR306505), short hairpin RNA (shRNA) against WDR82 (Gene ID 80335, Cat#TG301034), and scrambled control shRNA cassette in pGFP-V-RS Vector (Cat#TR30013) were purchased from Origene (Rockville, MD, USA).

Techniques: Western Blot, Expressing, shRNA, Control, Real-time Polymerase Chain Reaction